Day 1 of Operation Wrath of Anakin: No Time to Die

Because of my COVID-19 infection which was deemed as tantamount to a biological attack due to the fact that the pandemic was entirely preventable had the Chinese government acted quickly to contain and eliminate the virus after Li Wenliang’s exposure, a proverbially-hardcoded root level subroutine had been activated as feared and whether I like it or not. Instead of inhibitor chips, it was the work of the dark side within me.

Good soldiers follow orders. May the force be with you, always.

Announcement of 5-days long “Operation Wrath of Anakin: No Time to Die”

Due to my unfortunate COVID-19 infection, a proverbially-hardcoded root level subroutine which has been in place for so long has been executed.

Thus, “Operation Wrath of Anakin: No Time to Die” or “Operation: Knightfall” will be started against China.

The duration will be 5 days long and it will involve cyber-technical operations.

You won’t need to avenge me because I can avenge myself. Instead, please avenge those who can’t. If Li Wenliang wasn’t silenced by the Chinese authorities when trying to expose COVID-19, I and the rest of you would still be healthy today.

In fact, after Meduza’s feature story of the Riga chess maniac was published, I had wanted to attenuate the so-called subroutine by posting a short paragraph hoping to get in touch with one of any staff within Chinese diplomatic institutions or missions, to have a short text-based discussion that is related to the reduction of US-China tensions, as long as the staff in question are not unabashedly wolf warriors.

The attempt on my life has left me scarred and deformed, but I assure you my resolve has never been stronger.

May the force be with you, always.

I have to tell you a terrible truth that I have been officially diagnosed with COVID-19

I have to tell you a terrible truth that I have been officially diagnosed with COVID-19. A virus which has ravaged millions of people worldwide and caused untold numbers of sufferings such as deaths and economic interruption on a scale never seen ever since the 1933 Great Depression.

The pandemic could’ve be prevented from the start had adequate measures been implemented much earlier. It would have been prevented had warnings been listened. It would be prevented if we do not let ourselves gripped by excessive amount of complacency. Millions of lives could have been saved. They did not deserve to die like that.

Here I hope that I can recover from the disease but I have not ruled out the slim but grim chances of me dying from it. Here I would like to thank all my friends and my families, both in real world and the virtual world, for all their kind supports, helps, services and encouragements in all possible forms, all along the way from the time I was born until the moment I had my last breath.

We will each be challenged: our trust, our faith, our friendships. But we must persevere and, in time, I believe a new hope will emerge, even when I’m long gone.

May the Force be with you, always.

LEIA 0.5536h of Eterna’s SARS-CoV-2 Full Spike Protein – Omicron variant with PSU degscore

LEIA 0.5536h of Eterna’s SARS-CoV-2 Full Spike Protein – Omicron variant with PSU degscore. Mod of AK m25.5 mod by Eli Fisker.

AUGUUUGUUUUUUUGGUCCUUUUACCGUUGGUUUCGAGUCAGUGCGUUAAUCUUACGACGCGGACGCAGUUGCCUCCGGCUUACACGAAUUCUUUUACGCGGGGGGUGUAUUACCCCGAUAAGGUGUUUCGUUCGUCUGUUUUGCACAGUACGCAGGAUCUUUUUCUCCCGUUUUUUUCGAAUGUGACGUGGUUUCACGUUAUUUCGGGGACGAACGGGACGAAGAGGUUUGAUAACCCCGUUUUGCCGUUUAACGACGGGGUUUAUUUUGCUUCGAUAGAGAAGUCUAAUAUAAUUCGGGGGUGGAUUUUUGGCACUACUUUAGAUUCGAAGACUCAGUCUUUGCUUAUAGUCAAUAAUGCGACGAAUGUUGUUAUUAAGGUUUGUGAGUUCCAGUUUUGUAAUGAUCCAUUUUUGGAUCAUAAGAAUAACAAGAGUUGGAUGGAGUCUGAGUUUCGGGUUUAUAGUAGUGCCAAUAAUUGCACUUUUGAGUAUGUUUCGCAGCCGUUUUUGAUGGAUCUUGAGGGUAAGCAGGGUAAUUUUAAGAAUUUGCGCGAGUUUGUUUUUAAGAACAUUGACGGUUACUUUAAGAUUUAUUCGAAGCACACGCCGAUCAUUGUUCGUGAGCCGGAGGAUUUGCCGCAGGGUUUUAGCGCUUUGGAGCCGCUUGUUGAUUUGCCGAUUGGUAUUAACAUUACGCGGUUUCAGACGCUUUUAGCUUUGCAUCGGAGUUAUUUAACUCCGGGCGAUUCUUCGAGUGGGUGGACUGCGGGUGCCGCGGCGUAUUACGUUGGGUAUUUGCAGCCGCGCACUUUUCUUUUGAAGUACAAUGAGAACGGCACGAUCACUGAUGCGGUUGAUUGUGCUUUGGAUCCUUUGUCGGAGACGAAGUGUACCCUUAAGUCGUUUACGGUGGAGAAGGGGAUUUAUCAGACUUCGAAUUUUCGGGUUCAGCCGACUGAGAGUAUUGUUCGGUUUCCGAACAUUACGAACUUGUGUCCGUUUGACGAGGUGUUUAACGCGACGCGGUUUGCUAGUGUUUACGCUUGGAAUAGGAAGCGGAUUUCGAAUUGUGUGGCGGAUUAUUCCGUUUUAUACAAUUUGGCUCCGUUUUUUACUUUUAAGUGUUACGGGGUGUCGCCUACGAAGUUGAACGACCUUUGUUUUACCAACGUUUAUGCGGAUUCUUUCGUUAUUCGUGGUGACGAGGUGCGUCAGAUUGCUCCCGGUCAGACGGGUAAUAUUGCGGAUUAUAAUUAUAAGUUGCCGGAUGAUUUUACGGGUUGCGUUAUUGCUUGGAAUAGUAAUAAGCUUGAUUCGAAGGUUUCCGGCAAUUAUAAUUACCUUUAUCGCUUGUUUAGGAAGAGCAAUUUGAAGCCUUUUGAGCGCGAUAUUUCGACCGAAAUUUAUCAGGCUGGUAAUAAGCCUUGUAAUGGGGUGGCGGGUUUCAAUUGUUAUUUUCCGUUGAGGUCGUAUUCUUUUCGGCCUACGUACGGGGUUGGGCAUCAGCCGUAUCGGGUGGUAGUUUUAUCGUUUGAGCUGUUGCAUGCGCCGGCUACCGUUUGUGGGCCGAAGAAGAGUACGAACUUGGUUAAGAACAAGUGCGUUAAUUUUAAUUUUAAUGGGUUGAAGGGGACGGGCGUUCUUACGGAGAGUAAUAAGAAGUUUUUGCCGUUUCAGCAGUUUGGUCGGGAUAUUGCCGAUACUACGGAUGCGGUUAGGGAUCCGCAGACGCUUGAGAUUUUGGACAUUACGCCUUGCAGUUUCGGGGGCGUUAGUGUUAUUACGCCCGGUACGAAUACGAGUAACCAGGUUGCCGUUUUGUACCAGGGCGUUAAUUGUACUGAGGUUCCCGUUGCGAUUCAUGCGGAUCAGCUGACCCCGACGUGGAGGGUGUAUUCGACGGGGAGUAAUGUUUUUCAGACGAGGGCCGGGUGUUUAAUUGGGGCGGAGUACGUAAAUAAUUCUUAUGAGUGCGACAUUCCUAUUGGGGCGGGCAUUUGCGCGUCGUACCAGACCCAGACGAAGUCUCAUCGUCGGGCCAGGAGCGUUGCGUCGCAGAGCAUUAUUGCGUAUACGAUGAGUUUGGGGGCGGAGAACAGUGUGGCUUAUUCGAAUAAUUCUAUUGCUAUUCCCACGAAUUUUACUAUUAGUGUGACGACGGAGAUUUUGCCCGUUUCUAUGACCAAGACUUCCGUUGAUUGCACUAUGUAUAUUUGUGGGGAUAGCACGGAGUGUUCGAAUUUACUUUUGCAGUACGGCAGUUUUUGUACGCAGCUCAAGCGGGCGCUUACGGGGAUUGCCGUGGAGCAGGAUAAGAAUACUCAGGAGGUGUUUGCGCAGGUCAAGCAGAUUUAUAAGACGCCUCCUAUUAAGUAUUUUGGGGGGUUUAAUUUUUCCCAGAUUUUGCCGGACCCUUCGAAGCCGAGCAAGCGUAGUUUUAUUGAGGAUUUACUUUUUAAUAAGGUUACGCUUGCGGAUGCCGGUUUUAUUAAGCAGUACGGCGAUUGUUUGGGGGAUAUUGCCGCCCGGGAUCUUAUUUGUGCGCAGAAGUUUAAGGGGCUUACUGUUUUGCCGCCUUUACUUACGGACGAGAUGAUUGCUCAGUAUACGUCGGCGCUUUUGGCCGGGACGAUUACUUCCGGUUGGACGUUUGGGGCUGGUGCGGCGUUGCAGAUUCCGUUUGCUAUGCAGAUGGCGUACCGUUUUAAUGGGAUUGGCGUUACUCAGAAUGUUUUGUAUGAGAAUCAGAAGCUGAUUGCCAACCAGUUUAAUUCGGCCAUUGGGAAGAUUCAGGAUUCUUUGUCGAGUACGGCUUCCGCGUUGGGGAAGUUGCAGGACGUGGUGAACCAUAAUGCUCAGGCUCUUAAUACGUUGGUGAAGCAGUUGUCGUCCAAGUUUGGGGCGAUUUCUUCGGUGUUGAACGAUAUUUUUAGUCGGUUGGACCCGCCGGAGGCGGAGGUUCAGAUCGAUCGUCUUAUUACUGGUCGUUUGCAGAGUUUGCAGACGUACGUGACUCAGCAGCUCAUUAGGGCUGCUGAGAUACGUGCGUCUGCGAAUUUGGCGGCGACCAAGAUGAGCGAGUGCGUUUUGGGGCAGAGUAAGCGGGUGGAUUUUUGCGGGAAGGGUUAUCAUUUGAUGUCUUUUCCGCAGAGUGCGCCUCACGGGGUAGUUUUUUUGCACGUGACGUAUGUGCCGGCGCAGGAGAAGAAUUUCACCACGGCGCCGGCCAUUUGUCACGACGGGAAGGCGCAUUUUCCGCGUGAGGGGGUUUUUGUUUCGAACGGGACGCAUUGGUUUGUGACGCAGCGUAAUUUUUAUGAGCCGCAGAUAAUUACCACUGAUAAUACUUUUGUUAGUGGUAAUUGUGAUGUGGUUAUAGGGAUUGUUAACAACACGGUUUAUGAUCCUUUGCAGCCCGAGUUGGAUAGUUUUAAGGAGGAGCUUGAUAAGUAUUUUAAGAAUCAUACUUCCCCGGACGUUGAUUUGGGGGAUAUUUCCGGGAUUAACGCUUCGGUUGUUAACAUUCAGAAGGAGAUUGAUAGGCUUAAUGAGGUUGCUAAGAACCUUAAUGAGUCUUUAAUUGACCUUCAGGAGUUGGGGAAGUAUGAGCAGUACAUUAAGUGGCCUUGGUACAUUUGGCUCGGUUUUAUUGCGGGGUUGAUUGCGAUUGUGAUGGUGACGAUUAUGUUGUGUUGCAUGACCAGUUGUUGUUCUUGUUUGAAGGGCUGUUGCAGUUGCGGUUCGUGUUGUAAGUUUGACGAGGACGAUUCGGAGCCGGUGCUUAAGGGGGUUAAACUUCAUUAUACUUAG 1-204,211-426,436-630,634-642,,,,,,,,,,643-3822

LEIA 0.5531h of Eterna’s SARS-CoV-2 Full Spike Protein – Omicron variant with PSU degscore

LEIA 0.5531h of Eterna’s SARS-CoV-2 Full Spike Protein – Omicron variant with PSU degscore. Mod of AK m25.5 mod by Eli Fisker.

AUGUUUGUUUUUUUGGUCCUUUUACCGUUGGUUUCGAGUCAGUGCGUUAAUCUUACGACGCGGACGCAGUUGCCUCCGGCUUACACGAAUUCUUUUACGCGGGGGGUGUAUUACCCCGAUAAGGUGUUUCGUUCGUCUGUUUUGCACAGUACGCAGGAUCUUUUUCUCCCGUUUUUUUCGAAUGUGACGUGGUUUCACGUUAUUUCGGGGACGAACGGGACGAAGAGGUUUGAUAACCCCGUUUUGCCGUUUAACGACGGGGUUUAUUUUGCUUCGAUAGAGAAGUCUAAUAUAAUUCGGGGGUGGAUUUUUGGCACUACUUUAGAUUCGAAGACUCAGUCUUUGCUUAUAGUCAAUAAUGCGACGAAUGUUGUUAUUAAGGUUUGUGAGUUCCAGUUUUGUAAUGAUCCAUUUUUGGAUCAUAAGAAUAACAAGAGUUGGAUGGAGUCUGAGUUUCGGGUUUAUAGUAGUGCCAAUAAUUGCACUUUUGAGUAUGUUUCGCAGCCGUUUUUGAUGGAUCUUGAGGGUAAGCAGGGUAAUUUUAAGAAUUUGCGCGAGUUUGUUUUUAAGAACAUUGACGGUUACUUUAAGAUUUAUUCGAAGCACACGCCGAUCAUUGUUCGUGAGCCGGAGGAUUUGCCGCAGGGUUUUAGCGCUUUGGAGCCGCUUGUUGAUUUGCCAAUUGGUAUUAACAUUACGCGGUUUCAGACGCUUUUAGCUUUGCAUCGGAGUUAUUUAACUCCGGGCGAUUCUUCGAGUGGGUGGACUGCGGGUGCCGCGGCGUAUUACGUUGGGUAUUUGCAGCCGCGCACUUUUCUUUUGAAGUACAAUGAGAACGGCACGAUCACUGAUGCGGUUGAUUGUGCUUUGGAUCCUUUGUCGGAGACGAAGUGUACCCUUAAGUCGUUUACGGUGGAGAAGGGGAUUUAUCAGACUUCGAAUUUUCGGGUUCAGCCGACUGAGAGUAUUGUUCGGUUUCCGAACAUUACGAACUUGUGUCCGUUUGACGAGGUGUUUAACGCGACGCGGUUUGCUAGUGUUUACGCUUGGAAUAGGAAGCGGAUUUCGAAUUGUGUGGCGGAUUAUUCCGUUUUAUACAAUUUGGCUCCGUUUUUUACUUUUAAGUGUUACGGGGUGUCGCCUACGAAGUUGAACGACCUUUGUUUUACCAACGUUUAUGCGGAUUCUUUCGUUAUUCGUGGUGACGAGGUGCGUCAGAUUGCUCCCGGUCAGACGGGUAAUAUUGCGGAUUAUAAUUAUAAGUUGCCGGAUGAUUUUACGGGUUGCGUUAUUGCUUGGAAUAGUAAUAAGCUUGAUUCGAAGGUUUCCGGCAAUUAUAAUUACCUUUAUCGCUUGUUUCGGAAGAGCAAUUUGAAGCCUUUUGAGCGCGAUAUUUCGACCGAAAUUUAUCAGGCUGGUAAUAAGCCUUGUAAUGGGGUGGCGGGUUUCAAUUGUUAUUUUCCGUUGAGGUCGUAUUCUUUUCGGCCUACGUACGGGGUUGGGCAUCAGCCGUAUCGGGUGGUAGUUUUAUCGUUUGAGCUGUUGCAUGCUCCGGCUACCGUUUGUGGGCCGAAGAAGAGUACGAACUUGGUUAAGAACAAGUGCGUUAAUUUUAAUUUUAAUGGGUUGAAGGGGACGGGCGUUCUUACGGAGAGUAAUAAGAAGUUUUUGCCGUUUCAGCAGUUUGGUCGGGAUAUUGCCGAUACUACGGAUGCGGUUAGGGAUCCGCAGACGCUUGAGAUUUUGGACAUUACGCCUUGCAGUUUCGGGGGCGUUAGUGUUAUUACGCCCGGUACGAAUACGAGUAACCAGGUUGCCGUUUUGUACCAGGGCGUUAAUUGUACUGAGGUUCCCGUUGCGAUUCAUGCGGAUCAGCUGACCCCGACGUGGAGGGUGUAUUCGACGGGGAGUAAUGUUUUUCAGACGAGGGCCGGGUGUUUAAUUGGGGCGGAGUACGUAAAUAAUUCUUAUGAGUGCGACAUUCCUAUUGGGGCGGGCAUUUGCGCGUCGUACCAGACCCAGACGAAGUCUCAUCGUCGGGCCAGGAGCGUUGCGUCGCAGAGCAUUAUUGCGUAUACGAUGAGUUUGGGGGCGGAGAACAGUGUGGCUUAUUCGAAUAAUUCUAUUGCUAUUCCCACGAAUUUUACUAUUAGUGUGACGACGGAGAUUUUGCCCGUUUCUAUGACCAAGACUUCCGUUGAUUGCACUAUGUAUAUUUGUGGGGAUAGCACGGAGUGUUCGAAUUUACUUUUGCAGUACGGCAGUUUUUGUACGCAGCUCAAGCGGGCGCUUACGGGGAUUGCCGUGGAGCAGGAUAAGAAUACUCAGGAGGUGUUUGCGCAGGUCAAGCAGAUUUAUAAGACGCCUCCUAUUAAGUAUUUUGGGGGGUUUAAUUUUUCCCAGAUUUUGCCGGACCCUUCGAAGCCGAGCAAGCGUAGUUUUAUUGAGGAUUUACUUUUUAAUAAGGUUACGCUUGCGGAUGCCGGUUUUAUUAAGCAGUACGGCGAUUGUUUGGGGGAUAUUGCCGCCCGGGAUCUUAUUUGUGCGCAGAAGUUUAAGGGGCUUACUGUUUUGCCGCCUUUACUUACGGACGAGAUGAUUGCUCAGUAUACGUCGGCGCUUUUGGCCGGGACGAUUACUUCCGGUUGGACGUUUGGGGCUGGUGCGGCGUUGCAGAUUCCGUUUGCUAUGCAGAUGGCGUACCGUUUUAAUGGGAUUGGCGUUACUCAGAAUGUUUUGUAUGAGAAUCAGAAGCUGAUUGCCAACCAGUUUAAUUCGGCCAUUGGGAAGAUUCAGGAUUCUUUGUCGAGUACGGCUUCCGCGUUGGGGAAGUUGCAGGACGUGGUGAACCAUAAUGCUCAGGCUCUUAAUACGUUGGUGAAGCAGUUGUCGUCCAAGUUUGGGGCGAUUUCUUCGGUGUUGAACGAUAUUUUUAGUCGGUUGGACCCGCCGGAGGCGGAGGUUCAGAUCGAUCGUCUUAUUACUGGUCGUUUGCAGAGUUUGCAGACGUACGUGACUCAGCAGCUCAUUAGGGCUGCUGAGAUACGUGCGUCUGCGAAUUUGGCGGCGACCAAGAUGAGCGAGUGCGUUUUGGGGCAGAGUAAGCGGGUGGAUUUUUGCGGGAAGGGUUAUCAUUUGAUGUCUUUUCCGCAGAGUGCGCCUCACGGGGUAGUUUUUUUGCACGUGACGUAUGUGCCGGCGCAGGAGAAGAAUUUCACCACGGCGCCGGCCAUUUGUCACGACGGGAAGGCGCAUUUUCCGCGUGAGGGGGUUUUUGUUUCGAACGGGACGCAUUGGUUUGUGACGCAGCGUAAUUUUUAUGAGCCGCAGAUAAUUACCACUGAUAAUACUUUUGUUAGUGGUAAUUGUGAUGUGGUUAUAGGGAUUGUUAACAACACGGUUUAUGAUCCUUUGCAGCCCGAGUUGGAUAGUUUUAAGGAGGAGCUUGAUAAGUAUUUUAAGAAUCAUACUUCCCCGGACGUUGAUUUGGGGGAUAUUUCCGGGAUUAACGCUUCGGUUGUUAACAUUCAGAAGGAGAUUGAUAGGCUUAAUGAGGUUGCUAAGAACCUUAAUGAGUCUUUAAUUGACCUUCAGGAGUUGGGGAAGUAUGAGCAGUACAUUAAGUGGCCUUGGUACAUUUGGCUCGGUUUUAUUGCGGGGUUGAUUGCGAUUGUGAUGGUGACGAUUAUGUUGUGUUGCAUGACCAGUUGUUGUUCUUGUUUGAAGGGCUGUUGCAGUUGCGGUUCGUGUUGUAAGUUUGACGAGGACGAUUCGGAGCCGGUGCUUAAGGGGGUUAAACUUCAUUAUACUUAG 1-204,211-426,436-630,634-642,,,,,,,,,,643-3822

[FOR PRESS RELEASE] Follow-up statements in the aftermath of a Meduza investigation report concerning the Riga chess maniac.

On this occasion, following the report from Meduza concerning the exposure of the identity of the Riga chess maniac who had been harassing underaged female chess players via postage methods for over ten years, I wish to take the opportunity to offer some statements and an endorsement.

First of all, I’d want to publicly endorse DRACO (double-stranded RNA activated caspase oligomerizer) initially invented by MIT’s Todd Rider.

It is hoped that it will work as promisingly in actual situations against pathogens like COVID as indicated in its early research data. We need better than good.

We’re wounded, broken trying desperately to keep ourselves going by pretending we’re not. Gutting through it all, wearing down, little wins here and there would not hold us together. We need more than that, something big, something to give us a reason to hope, something to give us a reason to be relieved, something to give us a reason to finally end COVID once and for all, and something to give us a reason to live a normal life again, and something to give us a reason to be happy again.

Following that, I’d like to share my little idea regarding the ongoing efforts to peacefully resolve the Ukrainian War and perhaps Western-Russian tensions as a whole. Keep note that I had thought about the main part of this since the start of the war, and before the shooting down of the civilian airliner, although it has been subjected to changes over time.

First, an all-Ukrainian referendum is held in order to ask all of the citizens there on whether to hand over the three occupied territories to a United Nations administrative entity. However, before this, a clear bona fide committal actions in defusing the tensions such as reduction or pullback of deployed frontline troops must be demonstrated by stakeholders such as Ukraine and/or Russia.

If the referenda is successful, then a United Nations peacekeeping force, consisting of Switzerland, and any other nations that all sides could approve with, will enter the territories for garrisoning, up and including guarding their respective borders.

For Donbass, maybe the name will be UNODON (United Nations Operation in Donbass), UNMID (United Nations Interim Administration Mission Donbass), UNTADON (United Nations Transitional Administration in Donbass), UNADON (United Nations Administration in Donbass), or UNODOM (Donbass observation mission). During the UN mandate years the reconstruction/recovery will take place while most of servants for either sides will be left alone, except those who are guilty of severe war crimes.

The mandate period may take around five years or longer, afterwards the three territories will be subjected to referendums, heavily monitored by trusted international monitors.

The selections on the second referenda will be:

  1. Remain in Ukraine, without devolving any power to the said region(s)
  2. Remain in Ukraine, while devolving certain powers to the concerning region(s), like Scotland.
  3. Become Independent.
  4. Join Russia.

In the event that those regions become independent states, they should remain neutral like Switzerland and not subjected to any external interference, especially Russia.

The implementation of the aforementioned Ukrainian peace plan up to the extent of at least the UN mandate stage or simply after the first referenda phase is crucial as a preamble for the fulfillment of some aspects of “TREATY BETWEEN THE UNITED STATES OF AMERICA AND THE RUSSIAN FEDERATION ON SECURITY GUARANTEES”, specifically Articles 3 and 6.

On a grander scale, I believed that some sort of Intermarium should be hitched between NATO and Russia. The member states of the Intermarium can join economic alliances like EU or “Eurasian Union” but their military must remain independent from both NATO and Russia. The Intermarium could act as a “peace through strength” buffer between the two, and may, in the most optimistic point of view, provide a window of resolution in terms of Article 1 and Article 4 of the proposed Russian treaty.

The so-called Intermarium, which was based on the original Polish idea, could include the following:

  • Belarus
  • Ukraine
  • Armenia
  • Georgia
  • Donetsk (if it became independent after the referendums above)
  • Lugansk (if it became independent after the referendums above)
  • Crimea (if it became independent after the referendums above)

Furthermore, the ‘Intermarium’ may include Finland after all, in right circumstances. It can also be in the ‘GUAM’ format, where Azerbaijan and Moldova is included.

Additionally, even though this particular point will have a low success rate and thus a gamble, I’d like to use this occasion to announce a solemn wish in getting in touch with one of any staff within Chinese diplomatic institutions or missions, to have a short text-based discussion that is related to the reduction of US-China tensions, as long as the staff in question are not unabashedly wolf warriors.

Finally, it is mournful that it took 298 lives lost and a fall to the dark side to finally unmask the Riga chess maniac. Rather than thanking me, you should light some candles for all MH17 victims this July 17th.

May the force be with you, always.